BBa_K137073 1 BBa_K137073 313 non-coding spacer part 2008-08-07T11:00:00Z 2015-05-08T01:10:09Z PCR with synthesized primers off BioBrick part Q04400. 315 non-coding spacer part taken from the tail portion of tetR in Q04400. false false _187_ 0 3112 9 Not in stock false Since this DNA segment is a portion of tetR, this segment should not code for a protein and should not have a regulatory function. This part, with B0015, forms a composite part that has length 450 bp. false Allen Lin BBa_S04046 1 BBa_S04046 B0015:K137073 2008-08-07T11:00:00Z 2015-05-08T01:14:34Z true false _187_ 0 3112 9 Discontinued false false Allen Lin component1970704 1 BBa_B0010 component1970710 1 BBa_K137073 component1970706 1 BBa_B0012 annotation1970710 1 BBa_K137073 range1970710 1 138 450 annotation1970704 1 BBa_B0010 range1970704 1 1 80 annotation1970706 1 BBa_B0012 range1970706 1 89 129 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S04046_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagatactgagcacccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K137073_sequence 1 agatactgagcacccagtctttcgactgagcctttcgttttatttgatgcctggctctagtagtgatctacactagcactatcagtgttattaagctactaaagcgtagttttcgtcgtttgcagcggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z