BBa_K137010 1 fimE IRL fimE IRL 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat left recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963843 1 IRL in range1963843 1 1 17 annotation1963844 1 IRL out range1963844 1 19 35 BBa_S04068 1 BBa_S04068 B0025:K137070 2008-08-20T11:00:00Z 2015-05-08T01:14:34Z false false _187_ 0 3112 9 Not in stock false false Allen Lin component1973682 1 BBa_B0025 component1973688 1 BBa_K137008 component1973685 1 BBa_K137010 annotation1973682 1 BBa_B0025 range1973682 1 1 129 annotation1973685 1 BBa_K137010 range1973685 1 138 172 annotation1973688 1 BBa_K137008 range1973688 1 181 215 BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_K137008 1 IRR fimE IRR 2008-06-19T11:00:00Z 2015-05-08T01:10:08Z pFIP plasmid fimE inverted repeat right recombination site false false _187_ 0 3112 9 It's complicated false none false Allen Lin annotation1963841 1 IRR out range1963841 1 1 17 annotation1963842 1 IRR in range1963842 1 19 35 BBa_K137010_sequence 1 tctatgagtcaaaatggccccaattgtcttgtatt BBa_K137008_sequence 1 aagatgaaacatttggggccaaactgtccatatta BBa_S04068_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagagtctatgagtcaaaatggccccaattgtcttgtatttactagagaagatgaaacatttggggccaaactgtccatatta BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z