BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S04115 1 BBa_S04115 B0015:K137127 2008-10-15T11:00:00Z 2015-05-08T01:14:35Z false false _9_ 0 2018 9 Not in stock false false Robert Ovadia component1981725 1 BBa_B0010 component1981731 1 BBa_K137127 component1981727 1 BBa_B0012 annotation1981727 1 BBa_B0012 range1981727 1 89 129 annotation1981725 1 BBa_B0010 range1981725 1 1 80 annotation1981731 1 BBa_K137127 range1981731 1 138 272 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K137127 1 BBa_K137127 A81 Lac Promoter - Tight expression levels 2008-10-15T11:00:00Z 2015-05-08T01:10:11Z Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. A lactose inducible promoter obtained from: Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. Used for tight expression levels to maintain our lysis cassette genes. This allows the cell to lyse only when lactose is present, as for lysis at any other time may cause problems in our system. true false _187_ 0 2018 9 Discontinued false Ordered primers to PCR them out of the original plasmid, but they failed. Decided to order long primers and "dimerized" the promoter with restriction sites at the ends. false Robert Ovadia BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K137127_sequence 1 tatatctagagtacaacgtcgtgttagctgcaattgtgagcggataacaattgacatagcggatacttcctgatataattcgtgcaatttttaaacctgtaggatcgtacaggttactagtagcggccgctgcag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S04115_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtatatctagagtacaacgtcgtgttagctgcaattgtgagcggataacaattgacatagcggatacttcctgatataattcgtgcaatttttaaacctgtaggatcgtacaggttactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z