BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K137128 1 BBa_K137128 B4 Lac Promoter - Tight expression levels 2008-10-15T11:00:00Z 2015-05-08T01:10:11Z Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. An additional lactose inducible promoter (similar to A81) obtained from: Cox RS III, Surette MG, Elowitz MB. Programming gene expression with combinatorial promoters. Mol. Syst. Biol. 2007;3:145. Used for tight expression levels to maintain our lysis cassette genes. This allows the cell to lyse only when lactose is present, as for lysis at any other time may cause problems in our system. true false _187_ 0 2018 9 Discontinued false Ordered long primers and "dimerized" the promoter with restriction sites at the ends. false Robert Ovadia BBa_S04116 1 BBa_S04116 B0015:K137128 2008-10-15T11:00:00Z 2015-05-08T01:14:35Z true false _9_ 0 2018 9 Discontinued false false Robert Ovadia component1983827 1 BBa_B0010 component1983833 1 BBa_K137128 component1983829 1 BBa_B0012 annotation1983833 1 BBa_K137128 range1983833 1 138 272 annotation1983829 1 BBa_B0012 range1983829 1 89 129 annotation1983827 1 BBa_B0010 range1983827 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S04116_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtatatctagagtacaacgtcgtgttagttgcaattgtgagcggataacaattgacttgtgagcggataacaatgatacttcgtgcaatttttaaaattaaaggcgttacccaactactagtagcggccgctgcag BBa_K137128_sequence 1 tatatctagagtacaacgtcgtgttagttgcaattgtgagcggataacaattgacttgtgagcggataacaatgatacttcgtgcaatttttaaaattaaaggcgttacccaactactagtagcggccgctgcag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z