BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_S04151 1 BBa_S04151 S04149:S04150 2008-10-28T12:00:00Z 2015-05-08T01:14:36Z false false _9_ 0 2083 9 Not in stock false false Chun-Ju Yang component1995010 1 BBa_J36801 component1995013 1 BBa_B0012 component1995011 1 BBa_B0010 component1995003 1 BBa_R0040 component1995009 1 BBa_B0034 annotation1995011 1 BBa_B0010 range1995011 1 949 1028 annotation1995009 1 BBa_B0034 range1995009 1 63 74 annotation1995010 1 BBa_J36801 range1995010 1 83 940 annotation1995003 1 BBa_R0040 range1995003 1 1 54 annotation1995013 1 BBa_B0012 range1995013 1 1037 1077 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_J36801 1 KaiA KaiA coding region 2006-10-30T12:00:00Z 2015-08-31T04:08:47Z synthetic; GeneArt AG KaiA coding region with an extra stop codon at the end and two silent mutations at the EcoRI and PstI cut sites. From Prochlorococcus (Synechococcus) elongatus PCC7942 genome. The actual DNA is synthetic in nature; was synthesized from GeneArt AG. Note that the coding region is bounded by the BioBricks Primers and is on a non-BioBrick vector pGA4 (ampR). The biobricks primers can be cut out along with the KaiA coding sequence with HindIII and SacI. Length of entire plasmid is 3802bp. false false _65_ 0 1189 65 Not in stock false -none- false Zhipeng Sun BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J36801_sequence 1 gtgctctcgcaaattgcaatctgcatttgggtggaatcgacggcaattttgcaggattgccagcgggcgctgtcggccgatcgctatcaactccaagtctgtgagtctggcgaaatgctcttggagtatgcccaaacccatcgtgaccaaatcgactgcctgattttagtggcagccaatcccagcttcagggcagttgttcagcagctctgctttgagggagtggtggtaccagcgattgtcgtaggcgatcgcgacagtgaggatcccgatgaaccagccaaagaacagctctatcacagcgctgaactgcacctcggtatccatcagctcgagcaattgccctaccaagttgatgctgcactggctgaatttctgcgcttagccccggtcgagaccatggccgaccacatcatgctgatgggggccaaccacgatcccgagctatcgagccagcagcgggacctcgctcagcgactacaagagcgcctaggctatctcggggtctactacaagcgtgatcccgatcgctttctgcgcaacctacccgcctacgaaagccaaaagctgcaccaagcgatgcagactagctatcgtgaaatcgttttgagctatttttcgccgaatagcaacctcaaccagagcattgacaacttcgtcaacatggctttctttgccgatgttccagtcaccaaagtggtagaaattcacatggagctgatggacgagtttgccaagaagctccgcgtagagggacgttcagaggacattttgctggattatcggctgactttaattgatgtaattgcacatctttgtgagatgtatcgacggtctatcccacgagaaacctgatga BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_S04151_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagaggtgctctcgcaaattgcaatctgcatttgggtggaatcgacggcaattttgcaggattgccagcgggcgctgtcggccgatcgctatcaactccaagtctgtgagtctggcgaaatgctcttggagtatgcccaaacccatcgtgaccaaatcgactgcctgattttagtggcagccaatcccagcttcagggcagttgttcagcagctctgctttgagggagtggtggtaccagcgattgtcgtaggcgatcgcgacagtgaggatcccgatgaaccagccaaagaacagctctatcacagcgctgaactgcacctcggtatccatcagctcgagcaattgccctaccaagttgatgctgcactggctgaatttctgcgcttagccccggtcgagaccatggccgaccacatcatgctgatgggggccaaccacgatcccgagctatcgagccagcagcgggacctcgctcagcgactacaagagcgcctaggctatctcggggtctactacaagcgtgatcccgatcgctttctgcgcaacctacccgcctacgaaagccaaaagctgcaccaagcgatgcagactagctatcgtgaaatcgttttgagctatttttcgccgaatagcaacctcaaccagagcattgacaacttcgtcaacatggctttctttgccgatgttccagtcaccaaagtggtagaaattcacatggagctgatggacgagtttgccaagaagctccgcgtagagggacgttcagaggacattttgctggattatcggctgactttaattgatgtaattgcacatctttgtgagatgtatcgacggtctatcccacgagaaacctgatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z