BBa_S04159 1 BBa_S04159 K105001:K105012 2008-10-29T12:00:00Z 2015-05-08T01:14:36Z true false _9_ 0 3313 9 Discontinued false false Katja Karstens component1997056 1 BBa_K105001 component1997057 1 BBa_K105012 annotation1997056 1 BBa_K105001 range1997056 1 1 276 annotation1997057 1 BBa_K105012 range1997057 1 285 314 BBa_K105001 1 BBa_K105001 VP16 - eucaryotic activation domain 2008-10-11T11:00:00Z 2015-05-08T01:08:52Z We have constructed our BioBrick from the plasmid xxx, which was available in our hosting lab. Originally VP16 is a protein from the herpes simplex virus. It activates the transcription of the late genes of this virus by the RNA-polymerase II of the eucaryotic host. In artificial systems VP16 is used in fusion with a DNA-binding domain. This DNA-binding domain is specific for a bait sequence. So the selective expression of genes with a promoter containing this bait sequence can be achieved. false false _253_ 0 3313 9 It's complicated true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. <br\n> For more information about this issus, see Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." DSpace http://hdl.handle.net/1721.1/32535 (2006). true Manuel Gersbacher BBa_K105012 1 BBa_K105012 10 aa flexible protein domain linker 2008-10-18T11:00:00Z 2015-05-08T01:08:52Z Oligos with a yeast optimized coding for the peptide GENLYFQSGG have been ordered <br\n> The amino acide sequence corresponds to the interdomaine linker of xxx. ''paper'' This is a 10 amino acides long linker peptide which can be used to join protein domains together in a flexible way. So fusion proteins with variable DNA-binding and activation or repression domains might be assembled. <br\n> false true _253_ 0 3313 9 In stock true To enable the fusion with other domains in frame the vector of this BioBrick has no base pair in between the restriction side and the BioBrick. Furthermore, this coding sequence does not include a start codon.<br\n> For more information about this issus, see:<br\n> Phillips, I.E. and Silver, P.A. "A new Biobrick Assembly Strategy Designed for Facile Protein Engineering." <br\n> DSpace http://hdl.handle.net/1721.1/32535 (2006). true Manuel Gersbacher, Katja Karstens BBa_K105001_sequence 1 gctagcgccgccaccatgggccctaaaaagaagcgtaaagtcgcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccggggccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtggg BBa_S04159_sequence 1 gctagcgccgccaccatgggccctaaaaagaagcgtaaagtcgcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccggggccgggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagtttgagcagatgtttaccgatgcccttggaattgacgagtacggtgggtactagagggtgaaaatttgtattttcaatctggtggt BBa_K105012_sequence 1 ggtgaaaatttgtattttcaatctggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z