BBa_S04177 1 BBa_S04177 J70052:J70052 2009-02-06T12:00:00Z 2015-05-08T01:14:36Z false false _41_ 0 1201 41 Not in stock false false Julie Norville component2000498 1 BBa_J70052 component2000495 1 BBa_J70052 annotation2000498 1 BBa_J70052 range2000498 1 19 28 annotation2000495 1 BBa_J70052 range2000495 1 1 10 BBa_J70052 1 BBa_J70052 Right Library Insert Preparation Part (To use with J70050, and J70040) 2009-01-22T12:00:00Z 2015-05-08T01:08:20Z Designed Still in Testing Surround a part with J70050 and J70052, digest with AarI Insert into a vector that contained J70040 and had J70040 removed by AarI and MabI false false _41_ 0 1201 41 Not in stock false Not sure if one AarI site on each site will be enough. false Julie Norville annotation2000147 1 AarI range2000147 1 4 10 annotation2000146 1 Spacer range2000146 1 1 3 BBa_S04177_sequence 1 atagcaggtgtactagagatagcaggtg BBa_J70052_sequence 1 atagcaggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z