BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_E0038 1 BBa_E0038 lacZ alpha 2009-03-23T12:00:00Z 2015-08-31T04:07:25Z MG1655 lacZ alpha peptide DNA sequence derived from wildtype E. coli lacZ coding sequence false false _41_ 0 126 162 Not in stock false Doesn't have T7 or T3 promoter inside unlike BBa_E0035. false Reshma Shetty annotation2001937 1 lacZalpha range2001937 1 1 196 BBa_S04197 1 BBa_S04197 B0032:E0038 2009-04-08T11:00:00Z 2015-05-08T01:14:36Z false false _84_ 0 135 84 Not in stock false false Bartholomew Canton component2002278 1 BBa_B0032 component2002281 1 BBa_E0038 annotation2002281 1 BBa_E0038 range2002281 1 20 205 annotation2002278 1 BBa_B0032 range2002278 1 1 13 BBa_S04197_sequence 1 tcacacaggaaagtactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctaataa BBa_B0032_sequence 1 tcacacaggaaag BBa_E0038_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z