BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S04203 1 BBa_S04203 K137029:B0034 2009-05-31T11:00:00Z 2015-05-08T01:14:36Z false false _9_ 0 3112 9 Not in stock false false Allen Lin component2003921 1 BBa_K137029 component2003923 1 BBa_B0034 annotation2003921 1 BBa_K137029 range2003921 1 1 39 annotation2003923 1 BBa_B0034 range2003923 1 48 59 BBa_K137029 1 BBa_K137029 constitutive promoter with (TA)10 between -10 and -35 elements 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z This part was PCR amplified from two synthesized primers that bound to each other. constitutive promoter with (TA)10 between -10 and -35 elements false false _187_ 0 3112 9 It's complicated false With 10 TA repeats between the -10 and -35 elements, the distance between the two elements is optimal for the sigma factor to bind to the promoter. Thus, the promoter should be in the 'on' state. false Allen Lin annotation1967765 1 TA repeat range1967765 1 7 22 annotation1967764 1 -10 element range1967764 1 23 28 BBa_K137029_sequence 1 tttaattatatatatatatatatataatggaagcgtttt BBa_B0034_sequence 1 aaagaggagaaa BBa_S04203_sequence 1 tttaattatatatatatatatatataatggaagcgtttttactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z