BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K137030 1 BBa_K137030 constitutive promoter with (TA)9 between -10 and -35 elements 2008-07-20T11:00:00Z 2015-05-08T01:10:09Z This part was PCR amplified from two synthesized primers that bound to each other. constitutive promoter with (TA)9 between -10 and -35 elements false false _187_ 0 3112 9 It's complicated false With 9 TA repeats between the -10 and -35 elements, the distance between the two elements is not optimal for the sigma factor to bind to the promoter. Thus, the promoter should be in the 'off' state. false Allen Lin annotation1967766 1 -10 element range1967766 1 21 25 annotation1967767 1 TA repeat range1967767 1 7 20 BBa_S04204 1 BBa_S04204 K137030:B0034 2009-05-31T11:00:00Z 2015-05-08T01:14:36Z false false _9_ 0 3112 9 Not in stock false false Allen Lin component2003926 1 BBa_K137030 component2003928 1 BBa_B0034 annotation2003926 1 BBa_K137030 range2003926 1 1 37 annotation2003928 1 BBa_B0034 range2003928 1 46 57 BBa_B0034_sequence 1 aaagaggagaaa BBa_S04204_sequence 1 tttaattatatatatatatatataatggaagcgtttttactagagaaagaggagaaa BBa_K137030_sequence 1 tttaattatatatatatatatataatggaagcgtttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z