BBa_S04239 1 BBa_S04239 J23109:B0034 2009-08-04T11:00:00Z 2015-05-08T01:14:37Z false true _9_ 0 4975 9 Not in stock false false Jes??s P??rez Ju??rez component2014812 1 BBa_B0034 component2014810 1 BBa_J23109 annotation2014810 1 BBa_J23109 range2014810 1 1 35 annotation2014812 1 BBa_B0034 range2014812 1 44 55 BBa_J23109 1 BBa_J23109 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23109_sequence 1 tttacagctagctcagtcctagggactgtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_S04239_sequence 1 tttacagctagctcagtcctagggactgtgctagctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z