BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K249002 1 BBa_K249002 Lumazine Synthase 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z A Science Paper? Lumazine Synthase is an enzyme which creates Lumazine, a product which aggregates forming a hollow spheroid which can act as a mirocompartment, or artificial organelle. The Lumazine forms negatively charged pores, which can be used to introduce proteins. The proteins which are being introduced into the microcompartment must be equipped with an Arginine Tag. false false _242_342_ 0 3171 9 It's complicated true point mutations of EcoRI and PstI sites? false Roxanne Shank BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_S04259 1 BBa_S04259 K249002:B0015 2009-08-25T11:00:00Z 2015-05-08T01:14:37Z false true _9_ 0 3171 9 It's complicated false false Roxanne Shank component2061087 1 BBa_B0010 component2061089 1 BBa_B0012 component2061086 1 BBa_K249002 annotation2061086 1 BBa_K249002 range2061086 1 1 465 annotation2061089 1 BBa_B0012 range2061089 1 562 602 annotation2061087 1 BBa_B0010 range2061087 1 474 553 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K249002_sequence 1 atgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S04259_sequence 1 atgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z