BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_S04260 1 BBa_S04260 B0030:S04259 2009-08-25T11:00:00Z 2015-05-08T01:14:37Z false false _9_ 0 3171 9 It's complicated false false Roxanne Shank component2061099 1 BBa_K249002 component2061102 1 BBa_B0012 component2061100 1 BBa_B0010 component2061097 1 BBa_B0030 annotation2061099 1 BBa_K249002 range2061099 1 22 486 annotation2061102 1 BBa_B0012 range2061102 1 583 623 annotation2061100 1 BBa_B0010 range2061100 1 495 574 annotation2061097 1 BBa_B0030 range2061097 1 1 15 BBa_K249002 1 BBa_K249002 Lumazine Synthase 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z A Science Paper? Lumazine Synthase is an enzyme which creates Lumazine, a product which aggregates forming a hollow spheroid which can act as a mirocompartment, or artificial organelle. The Lumazine forms negatively charged pores, which can be used to introduce proteins. The proteins which are being introduced into the microcompartment must be equipped with an Arginine Tag. false false _242_342_ 0 3171 9 It's complicated true point mutations of EcoRI and PstI sites? false Roxanne Shank BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K249002_sequence 1 atgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctag BBa_S04260_sequence 1 attaaagaggagaaatactagatgcagatttatgaaggcaaactgaccgcggaaggcctgcgctttggcattgtggcgagccgctttaaccatgcgctggtggatcgcctggtggaaggcgcgattgattgcattgtgcgccatggtggtcgcgaagaagatattaccctggtgcgcgtgccgggcagctgggaaattccggtggcggcgggcgaactggcgcgcaaagaagatattgatgcggtgattgcgattggcgtgctgattgaaggcgcggaaccgcattttgattatattgcgagcgaagtgagcaaaggcctggcgaacctgagcctggaactgcgcaaaccgattacctttggcgtgattaccgcggatgaactggaagaagcgattgaacgcgcgggcaccaaacatggcaacaaaggctgggaagcggcgctgagcgcgattgaaatggcgaacctgtttaaaagcctgcgctagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z