BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_S04261 1 BBa_S04261 K249005:B0015 2009-08-25T11:00:00Z 2015-05-08T01:14:37Z false false _9_ 0 3171 9 It's complicated false false Roxanne Shank component2061110 1 BBa_B0012 component2061107 1 BBa_K249005 component2061108 1 BBa_B0010 annotation2061110 1 BBa_B0012 range2061110 1 130 170 annotation2061107 1 BBa_K249005 range2061107 1 1 33 annotation2061108 1 BBa_B0010 range2061108 1 42 121 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K249005 1 BBa_K249005 C-terminal Arginine Fusion Vector 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z Synthesized DNA pSB1A3 with an C-terminal Arginine tag. This particular plasmid utilizes the BioFusion (aka Silver Lab) Standard for BioBrick assembly. Adds 10 Arginine residues to the C-terminus of a Protein (Includes Stop Codon) false false _342_ 0 3171 9 It's complicated true Standard false Roxanne Shank BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K249005_sequence 1 cgccgccgccgccgccgccgccgccgccgctaa BBa_S04261_sequence 1 cgccgccgccgccgccgccgccgccgccgctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z