BBa_K249004 1 BBa_K249004 N-terminal Arginine fusion vector 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z Synthesized Tag pSB1A3 with an N-terminal Arginine tag. This particular plasmid utilizes the BioFusion (aka Silver Lab) Standard for BioBrick assembly. Adds 10 Arginine residues to the N-terminus of a Protein. false false _342_ 0 3171 9 It's complicated true Standard false Roxanne Shank BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_S04262 1 BBa_S04262 B0032:K249004 2009-08-25T11:00:00Z 2015-05-08T01:14:37Z false false _9_ 0 3171 9 It's complicated false false Roxanne Shank component2061115 1 BBa_B0032 component2061117 1 BBa_K249004 annotation2061115 1 BBa_B0032 range2061115 1 1 13 annotation2061117 1 BBa_K249004 range2061117 1 20 52 BBa_B0032_sequence 1 tcacacaggaaag BBa_S04262_sequence 1 tcacacaggaaagtactagatgcgccgccgccgccgccgccgccgccgccgc BBa_K249004_sequence 1 atgcgccgccgccgccgccgccgccgccgccgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z