BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_S04268 1 BBa_S04268 K249016:B0015 2009-08-25T11:00:00Z 2015-05-08T01:14:37Z false false _9_ 0 3171 9 It's complicated false false Roxanne Shank component2061151 1 BBa_B0012 component2061148 1 BBa_K249016 component2061149 1 BBa_B0010 annotation2061151 1 BBa_B0012 range2061151 1 283 323 annotation2061149 1 BBa_B0010 range2061149 1 195 274 annotation2061148 1 BBa_K249016 range2061148 1 1 186 BBa_K249016 1 BBa_K249016 mms6 2009-08-25T11:00:00Z 2015-05-08T01:11:40Z A Science Paper? mms6 is an enzyme which creates nanoparticles. false false _242_342_ 0 3171 9 It's complicated false point mutations of EcoRI and PstI sites? false Roxanne Shank BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K249016_sequence 1 atggtcggtggaaccatctggaccggtaaggggctgggcctcggtctgggtctcggtctgggcgcgtgggggccgatcattctcggcgttgttggcgccggggcggtttacgcatatatgaagagccgtgatatcgaatcggcgcagagcgacgaggaagtcgaactgcgcgacgcgctggcctga BBa_S04268_sequence 1 atggtcggtggaaccatctggaccggtaaggggctgggcctcggtctgggtctcggtctgggcgcgtgggggccgatcattctcggcgttgttggcgccggggcggtttacgcatatatgaagagccgtgatatcgaatcggcgcagagcgacgaggaagtcgaactgcgcgacgcgctggcctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z