BBa_K175027 1 I-SceI RS I-SceI restriction site 2009-07-31T11:00:00Z 2015-05-08T01:10:59Z synthesised I-SceI homing endonuclease site Restriction site for the homing endonuclease I-SceI. Sequence will be cut as follows: 5' A G T T A C G C T A G G G A T A A^C A G G G T A A T A T A G 3' 3' T C A A T G C G A T C C C^T A T T G T C C C A T T A T A T C 5' false false _280_ 0 4302 9 It's complicated true Design was very simple. The recognition site was copied from NEB and synthesised false Tim Weenink annotation2014585 1 I-SceI homing endonuclease restriction site range2014585 1 1 30 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_S04296 1 BBa_S04296 R0040:K175027 2009-10-10T11:00:00Z 2015-05-08T01:14:38Z false true _9_ 0 4302 9 It's complicated false false Tim_Weenink component2033488 1 BBa_R0040 component2033494 1 BBa_K175027 annotation2033488 1 BBa_R0040 range2033488 1 1 54 annotation2033494 1 BBa_K175027 range2033494 1 63 92 BBa_S04296_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagagttacgctagggataacagggtaatatag BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K175027_sequence 1 agttacgctagggataacagggtaatatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z