BBa_K179000 1 BBa_K179000 XRE human enhancer enhanced by Ahr-Arnt-dioxin complex 2009-10-17T11:00:00Z 2015-05-08T01:11:05Z XRE human genomic sequence XRE works as dioxin sensor when co-expressed with Arnt and Ahr. Dioxin first binds to the Ahr protein, and this Dioxin-Ahr binds to Arnt. The resulting complex in cytosol is then transfered to the nucleus and bind to the XRE sequences, which works as enhancer of downstream promoter. false false _300_ 0 5071 9 Not in stock false To use as a dioxin sensor, you must use this part with Arnt and Ahr protein coding devices. false Yoko Tomizawa annotation2049341 1 XRE range2049341 1 29 41 annotation2049340 1 XRE range2049340 1 15 28 annotation2049339 1 XRE range2049339 1 1 14 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_S04315 1 BBa_S04315 K179000:B0015 2009-10-17T11:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 4185 9 Not in stock false false Koji Tanaka component2049453 1 BBa_K179000 component2049456 1 BBa_B0012 component2049454 1 BBa_B0010 annotation2049453 1 BBa_K179000 range2049453 1 1 42 annotation2049454 1 BBa_B0010 range2049454 1 51 130 annotation2049456 1 BBa_B0012 range2049456 1 139 179 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S04315_sequence 1 atccttgcgtgacaatccttgcgtgacaatccttgcgtgcattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K179000_sequence 1 atccttgcgtgacaatccttgcgtgacaatccttgcgtgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z