BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_S04319 1 BBa_S04319 K285101:K143021 2009-10-17T11:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5327 9 It's complicated false false Xing Xiong component2051530 1 BBa_K285101 component2051532 1 BBa_K143021 annotation2051532 1 BBa_K143021 range2051532 1 71 82 annotation2051530 1 BBa_K285101 range2051530 1 1 62 BBa_K285101 1 cadA promo cadA regulatory region 2009-08-09T11:00:00Z 2015-05-08T01:11:48Z 48 bases upstream of cadA gene in B. subtilis. strain 168. Regulatory sequence upstream of the cadA gene (previously known as yvgW). This sequence is part of the czrA regulon and is regulated by the CzrA repressor which is derepressed in the presence of Cd2+. false false _389_ 0 5327 9 It's complicated false None. false Xing Xiong BBa_K285101_sequence 1 ttttgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgag BBa_K143021_sequence 1 aaaggtggtgaa BBa_S04319_sequence 1 ttttgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtactagagaaaggtggtgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z