BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_S04331 1 BBa_S04331 I1051:B0015 2009-11-03T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 3663 9 Not in stock false false Eniak Hernandez component2062612 1 BBa_B0010 component2062614 1 BBa_B0012 component2062607 1 BBa_I1051 annotation2062612 1 BBa_B0010 range2062612 1 77 156 annotation2062614 1 BBa_B0012 range2062614 1 165 205 annotation2062607 1 BBa_I1051 range2062607 1 1 68 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I1051 1 Lux Lux cassette right promoter 2003-01-31T12:00:00Z 2015-08-31T04:07:30Z <em>V. fishceri</em> and phage lambda (courtesy of Ron Weiss) The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.In thisversion, a binding site for cI dimer has been added: binding to this site dominantly represses transcription.</p> false true _1_ 0 24 7 It's complicated false <P> <P><P> false Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1936 1 LuxR/HSL range1936 1 1 20 annotation1937 1 -35 range1937 1 20 25 annotation1940 1 start range1940 1 53 53 annotation1939 1 cI (OR1) range1939 1 52 68 annotation7059 1 BBa_I1051 range7059 1 1 68 annotation1938 1 -10 range1938 1 42 47 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I1051_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgata BBa_S04331_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatacctctggcggtgatatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z