BBa_K199028 1 BBa_K199028 CGGUC tRNA Suppressor (Produces Serine) 2009-07-08T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CGGUC, which would normally cause a frame shift mutation. false false _295_ 0 5117 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CGGUC. false Alyndria Thompson annotation2010430 1 anticodon loop range2010430 1 44 52 annotation2010431 1 5' context range2010431 1 1 11 annotation2010432 1 3 range2010432 1 104 143 BBa_K199106 1 BBa_K199106 pLpp promoter 2009-11-18T12:00:00Z 2015-05-08T01:11:20Z The sequence matches that naturally found in E. coli. The lpp promoter is one of the strongest promoters in E. coli. false false _295_ 0 5562 9 Not in stock false n/a false Mary Gearing BBa_S04334 1 BBa_S04334 K199106:K199028 2009-11-18T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2062784 1 BBa_K199106 component2062788 1 BBa_K199028 annotation2062788 1 BBa_K199028 range2062788 1 58 200 annotation2062784 1 BBa_K199106 range2062784 1 1 49 BBa_K199028_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_K199106_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacg BBa_S04334_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtttgaccgacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z