BBa_K199106 1 BBa_K199106 pLpp promoter 2009-11-18T12:00:00Z 2015-05-08T01:11:20Z The sequence matches that naturally found in E. coli. The lpp promoter is one of the strongest promoters in E. coli. false false _295_ 0 5562 9 Not in stock false n/a false Mary Gearing BBa_S04335 1 BBa_S04335 K199106:K199000 2009-11-18T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2062793 1 BBa_K199000 component2062789 1 BBa_K199106 annotation2062789 1 BBa_K199106 range2062789 1 1 49 annotation2062793 1 BBa_K199000 range2062793 1 58 200 BBa_K199000 1 BBa_K199000 CCCUC tRNA Suppressor (Produces Serine) 2009-06-24T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCCUC, which would normally cause a frame shift mutation. false false _295_ 0 5114 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCCUC. false Leland Taylor annotation2006690 1 3' Context range2006690 1 104 143 annotation2006689 1 5' Context range2006689 1 1 11 annotation2006688 1 Anti-codon Loop range2006688 1 44 52 BBa_K199106_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacg BBa_K199000_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_S04335_sequence 1 atcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgtactagagggatccaattcggagagatgccggagcggctgaacggaccggtctgagggtcaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z