BBa_K091117 1 BBa_K091117 pLas promoter 2008-06-25T11:00:00Z 2015-05-08T01:08:37Z The sequence of the LasI upstream regulatory region is available at http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=176640 This pLas' promoter contains the regulatory region upstream of the LasI gene in Pseudomonas aeruginosa. K091117 includes a LasR binding site as well as a -10 region modified from CATAAA to TATAAA to reflect our pLasXOR promoter design. Activation is expected to occur in the presence of the autoinducer PAI-1 and the LasR protein. The pLas' promoter serves as a control for the evaluation of the pLasXOR promoter, part BBa_K091118. false true _191_ 0 3067 9 It's complicated false To minimize leaky transcription, a secondary transcriptional start site was excluded from the design. false Erin Feeney annotation1964073 1 LasR Binding Site range1964073 1 75 93 annotation1964072 1 -35 Region range1964072 1 86 91 annotation1964074 1 -10 Region range1964074 1 113 118 annotation1964075 1 Primary Transcriptional Start range1964075 1 125 125 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S04340 1 BBa_S04340 K091117:B0034 2009-12-07T12:00:00Z 2015-05-08T01:14:38Z false false _9_ 0 3663 9 Not in stock false false Eniak Hernandez component2062977 1 BBa_K091117 component2062979 1 BBa_B0034 annotation2062979 1 BBa_B0034 range2062979 1 135 146 annotation2062977 1 BBa_K091117 range2062977 1 1 126 BBa_B0034_sequence 1 aaagaggagaaa BBa_K091117_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgtataaattcttcag BBa_S04340_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgtataaattcttcagtactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z