BBa_K091146 1 BBa_K091146 pLas/Lux Hybrid Promoter 2008-07-16T11:00:00Z 2015-05-08T01:08:38Z The LuxR binding site is from BBa_R0062 and the pLas' promoter is from the region upstream of the LasI gene in Pseudomonas aeruginosa. Released HQ 2013 K091146 is a modified version of the pLas' promoter (BBa_K091117) containing the addition of a luxR binding site between the -35 and -10 regions. This promoter is expected to be activated in the presence of PAI-1 and LasR and repressed in the presence of AI-1 and LuxR. false false _191_ 0 3067 9 In stock true The Lux box was placed adjacent to the LasR binding site with the aim of minimizing cross-talk in the presence of both PAI-1 and AI-1; since the LasR site should have a higher affinity, we hope that the binding of PAI-1 will competitively exclude the binding of AI-1. true Erin Feeney annotation1967357 1 -35 range1967357 1 86 91 annotation1967355 1 LuxR range1967355 1 94 113 annotation1967356 1 -10 range1967356 1 113 118 annotation1967354 1 LasR range1967354 1 75 93 annotation1967358 1 Transcriptional Start range1967358 1 125 125 BBa_S04384 1 BBa_S04384 K091146:B0034 2009-12-07T12:00:00Z 2015-05-08T01:14:39Z false true _9_ 0 3663 9 Not in stock false false Eniak Hernandez component2063897 1 BBa_K091146 component2063899 1 BBa_B0034 annotation2063897 1 BBa_K091146 range2063897 1 1 126 annotation2063899 1 BBa_B0034 range2063899 1 135 146 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K091146_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagtacctgtaggatcgtacaggtataaattcttcag BBa_S04384_sequence 1 tgttctcgtgtgaagccattgctctgatcttttggacgtttcttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagtacctgtaggatcgtacaggtataaattcttcagtactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z