BBa_R0077 1 cinR Promoter (cinR and HSL regulated, RBS+) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z Rhizobium leguminosarum Released HQ 2013 CinR (BBa_C0077) in complex with O3-C14:1-HSL (from CinI, BBa_C0076) binds to this promoter and activates transcription. This promoter contains the RBS: TGGAGG false false _1_ 0 24 7 In stock false The regulatory locus cinRI in Rhizobium leguminosarum conrols a network of quorum-sensing loci Lithgow, JK; Wilkinson, A; Hardman, A; Rodelas, B; Wisniewski-Dye, F; Williams, P; Downie, AJ MOL. MICROBIOLOGY 37(1): 81-97, 2000 Change log: the last 5 bases (gctaa) removed to allow for the correct spacing between the RBS (TGGAGG) and the start of the downstream gene after biobricks splicing. true crackdots annotation301205 1 stem_loop range301205 1 91 136 annotation301371 1 unidentified/uncharacterized CinR dependent range301371 1 1 220 annotation301150 1 embedded RBS range301150 1 226 231 annotation301204 1 stem_loop range301204 1 35 74 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S04394 1 BBa_S04394 R0077:B0034 2009-12-07T12:00:00Z 2015-05-08T01:14:39Z false true _9_ 0 3663 9 Not in stock false false Eniak Hernandez component2064087 1 BBa_B0034 component2064085 1 BBa_R0077 annotation2064085 1 BBa_R0077 range2064085 1 1 231 annotation2064087 1 BBa_B0034 range2064087 1 240 251 BBa_R0077_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgctggagg BBa_B0034_sequence 1 aaagaggagaaa BBa_S04394_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgctggaggtactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z