BBa_S04418 1 BBa_S04418 S04279:K199008 2010-01-22T12:00:00Z 2015-05-08T01:14:39Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2065550 1 BBa_K199002 component2065554 1 BBa_K199008 component2065542 1 BBa_R0040 annotation2065542 1 BBa_R0040 range2065542 1 1 54 annotation2065554 1 BBa_K199008 range2065554 1 214 357 annotation2065550 1 BBa_K199002 range2065550 1 63 205 BBa_K199008 1 BBa_K199008 CCAUC Suppressor tRNA (10-bp Anticodon and Produces Serine) 2009-06-28T11:00:00Z 2015-05-08T01:11:18Z De novo synthesis from single-stranded oligos. Based on the paper by Anderson et al. 2002. [http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf] This gene encodes for a tRNA suppressor that suppresses a 5-bp codon CCAUC, which would normally cause a frame shift mutation. false false _295_ 0 5112 9 It's complicated false We used the 10-bp anticodon loop that is complementary to the 5-bp codon CCAUC. false Olivia Ho-Shing annotation2006985 1 Anticodon Loop range2006985 1 44 53 annotation2006984 1 5' Context range2006984 1 1 11 annotation2006986 1 3' Context range2006986 1 105 144 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 BBa_K199002 1 BBa_K199002 CCACU tRNA Suppressor (Produces Serine) 2009-06-25T11:00:00Z 2015-05-08T01:11:18Z De Novo synthesis from oligos. Based on the paper by Anderson et al. (http://gcat.davidson.edu/GcatWiki/images/6/6f/AndersonSchultz2002ChemBiol.pdf) This gene encodes for a 5 base pair tRNA suppressor that suppresses CCACU, which would normally cause a frame shift mutation. false false _295_ 0 5109 9 It's complicated false We used the 9 base anticodon loop that is complementary to the 5 base pair codon CCACU. false Shamita Punjabi annotation2006708 1 Anticodon Loop range2006708 1 44 52 annotation2006707 1 5' Context range2006707 1 1 11 annotation2006709 1 3' Context range2006709 1 104 143 BBa_K199002_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K199008_sequence 1 ggatccaattcggagagatgccggagcggctgaacggaccggttttgatggagaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct BBa_S04418_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagggatccaattcggagagatgccggagcggctgaacggaccggtctagtggacaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagcttactagagggatccaattcggagagatgccggagcggctgaacggaccggttttgatggagaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatatccttagcgaaagctaaggattttttttaagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z