BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2045 1 LuxR/HSL range2045 1 1 20 annotation2047 1 -10 range2047 1 42 47 annotation2046 1 -35 range2046 1 20 25 annotation2048 1 start range2048 1 53 53 annotation7070 1 BBa_R0062 range7070 1 1 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_S04426 1 BBa_S04426 K199114:K199143 2010-04-08T11:00:00Z 2015-05-08T01:14:40Z false false _9_ 0 5562 9 Not in stock false false Mary Gearing component2067679 1 BBa_R0062 component2067672 1 BBa_B0010 component2067684 1 BBa_B0034 component2067674 1 BBa_B0012 component2067685 1 BBa_K199143 annotation2067684 1 BBa_B0034 range2067684 1 201 212 annotation2067674 1 BBa_B0012 range2067674 1 89 129 annotation2067679 1 BBa_R0062 range2067679 1 138 192 annotation2067685 1 BBa_K199143 range2067685 1 219 850 annotation2067672 1 BBa_B0010 range2067672 1 1 80 BBa_K199143 1 BBa_K199143 LuxI with CGGUC frameshift 2010-04-08T11:00:00Z 2015-05-08T01:11:20Z optimized LuxI + CGGUC This is the 1-SAT CGGUC problem. This part does not exist due to assembly method- it only exists as a part of the full positive feedback loop. false false _295_ 0 5562 9 Not in stock false n/a false Mary Gearing BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K199143_sequence 1 atggcgatcgcacggtctctgggcgcgccgcaattgcaagcggtcgtgcaaccattatgattaaaaaaagcgattttctggccattccgagcgaagaatataaaggtattctgagcctgcgctatcaggtttttaaacagcgtctggaatgggatctggtggttgaaaataatctggaaagtgatgaatatgataatagcaatgccgaatatatttatgcctgtgatgataccgaaaatgttagcggttgttggcgtctgctgccgaccaccggtgattatatgctgaaaagcgtttttccggaactgctgggtcagcagagcgcaccgaaagatccgaatattgttgaactgagccgttttgccgtgggtaaaaatagcagcaaaattaataatagcgccagcgaaattaccatgaaactgtttgaagccatttataaacatgccgttagccagggtattaccgaatatgttaccgttaccagcaccgcaattgaacgttttctgaaacgtattaaagtgccgtgtcatcgtattggcgataaagaaattcatgttctgggcgataccaaaagcgttgttctgagcatgccgattaatgaacagtttaaaaaagccgtgctgaactaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S04426_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaatactagatggcgatcgcacggtctctgggcgcgccgcaattgcaagcggtcgtgcaaccattatgattaaaaaaagcgattttctggccattccgagcgaagaatataaaggtattctgagcctgcgctatcaggtttttaaacagcgtctggaatgggatctggtggttgaaaataatctggaaagtgatgaatatgataatagcaatgccgaatatatttatgcctgtgatgataccgaaaatgttagcggttgttggcgtctgctgccgaccaccggtgattatatgctgaaaagcgtttttccggaactgctgggtcagcagagcgcaccgaaagatccgaatattgttgaactgagccgttttgccgtgggtaaaaatagcagcaaaattaataatagcgccagcgaaattaccatgaaactgtttgaagccatttataaacatgccgttagccagggtattaccgaatatgttaccgttaccagcaccgcaattgaacgttttctgaaacgtattaaagtgccgtgtcatcgtattggcgataaagaaattcatgttctgggcgataccaaaagcgttgttctgagcatgccgattaatgaacagtttaaaaaagccgtgctgaactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z