BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_S04462 1 BBa_S04462 R0040:K315007 2010-07-13T11:00:00Z 2015-05-08T01:14:40Z false true _9_ 0 7373 9 Not in stock false false Anvi Raina component2073703 1 BBa_K315007 component2073695 1 BBa_R0040 annotation2073703 1 BBa_K315007 range2073703 1 63 96 annotation2073695 1 BBa_R0040 range2073695 1 1 54 BBa_K315007 1 BBa_K315007 Lox N forward 2010-06-17T11:00:00Z 2015-05-08T01:11:55Z We learned about the use of variant lox sites to produce random fluorescent protein expression from the "Brainbow" paper (http://www.nature.com/nature/journal/v450/n7166/full/nature06293.html). The cre-lox system is used for site-specific recombination. Lox sites are 34 bp sequences of DNA that flank coding sequences. When cre recombinase is introduced, it can excise or invert the portions of DNA between two lox sites. If the two lox sites flanking the coding sequence are both forward or both reverse, the coding sequence will be excised, leaving one lox site behind. If one site is forward and the other reverse, the coding sequence will be inverted. false false _435_ 0 7373 9 It's complicated false In constructing variant lox sites, we looked for the least promiscuous sites - those that had the lowest rates of recombination with other variants. false Anvi Raina annotation2071528 1 Arm (Inverted Repeat) range2071528 1 1 13 annotation2071530 1 Arm (Inverted Region) range2071530 1 22 34 annotation2071529 1 Spacer Region range2071529 1 14 21 BBa_K315007_sequence 1 ataacttcgtataaggtatactatacgaagttat BBa_S04462_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataaggtatactatacgaagttat BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z