BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S04419 1 BBa_S04419 B0034:E1010 2010-01-22T12:00:00Z 2015-05-08T01:14:39Z Released HQ 2013 false false _9_ 0 5562 9 In stock false false Mary Gearing component2244399 1 BBa_E1010 component2244396 1 BBa_B0034 annotation2244396 1 BBa_B0034 range2244396 1 1 12 annotation2244399 1 BBa_E1010 range2244399 1 19 724 BBa_S04467 1 BBa_S04467 K315017:S04419 2010-07-14T11:00:00Z 2015-05-08T01:14:40Z false false _9_ 0 7372 9 Not in stock false false Nitya Rao component2250203 1 BBa_S04419 component2250197 1 BBa_K315017 annotation2250197 1 BBa_K315017 range2250197 1 1 96 annotation2250203 1 BBa_S04419 range2250203 1 105 828 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_K315001 1 BBa_K315001 variant forward lox site with 2 base changes in the spacer region (lox5171) 2010-06-14T11:00:00Z 2015-05-08T01:11:55Z We learned about the use of variant lox sites to produce random fluorescent protein expression from the "Brainbow" paper (http://www.nature.com/nature/journal/v450/n7166/full/nature06293.html). We discovered this specific sequence in "Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination" (http://www.ncbi.nlm.nih.gov/pubmed/9714735). The cre-lox system is used for site-specific recombination. Lox sites are 34 bp sequences of DNA that flank coding sequences. When cre recombinase is introduced, it can excise or invert the portions of DNA between two lox sites. If the two lox sites flanking the coding sequence are both forward or both reverse, the coding sequence will be excised, leaving one lox site behind. If the one site is forward and the other reverse, the coding sequence will be inverted. false false _435_ 0 7372 9 It's complicated false In constructing variant lox sites, we looked for the least promiscuous sites - those that had the lowest rates of recombination with other variants. false Nitya Rao annotation2070869 1 Arm (Inverted Repeat) range2070869 1 1 13 annotation2070870 1 Spacer Region range2070870 1 14 21 annotation2070871 1 Arm (Inverted Repeat) range2070871 1 22 34 BBa_K315017 1 BBa_K315017 pTet + lox5171 Forward 2010-07-08T11:00:00Z 2015-05-08T01:11:55Z We created this part as one step in our project. This a promoter followed by a variant lox site. false false _435_ 0 7372 9 Not in stock false This a good construct to begin when attempting to test how variant lox sites recombine. false Nitya Rao component2072781 1 BBa_K315001 component2072773 1 BBa_R0040 annotation2072781 1 BBa_K315001 range2072781 1 63 96 annotation2072773 1 BBa_R0040 range2072773 1 1 54 BBa_B0034_sequence 1 aaagaggagaaa BBa_K315001_sequence 1 ataacttcgtataatgtgtactatacgaagttat BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_S04467_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataatgtgtactatacgaagttattactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K315017_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataatgtgtactatacgaagttat BBa_S04419_sequence 1 aaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z