BBa_S04487 1 BBa_S04487 S04460:K093005 2010-07-23T11:00:00Z 2015-05-08T01:14:40Z false false _9_ 0 7379 9 Not in stock false false Tom Shuman component2250261 1 BBa_K093005 component2250255 1 BBa_S04460 annotation2250261 1 BBa_K093005 range2250261 1 105 828 annotation2250255 1 BBa_S04460 range2250255 1 1 96 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K093005 1 RBS-RFP RFP with RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:40Z registry plasmids Released HQ 2013 RFP, BBa_E1010, with Elowitz RBS, BBa_B0034. false false _247_ 0 3630 9 In stock false The part was needed for downstream applications. There can be no expression of a reporter without a ribosome binding site. true Kathy Lam, Danielle Nash component2244025 1 BBa_E1010 component2244022 1 BBa_B0034 annotation2244022 1 BBa_B0034 range2244022 1 1 12 annotation2244025 1 BBa_E1010 range2244025 1 19 724 BBa_K315004 1 BBa_K315004 variant forward lox site with 3 base changes in the spacer region (loxm2 forward) 2010-06-15T11:00:00Z 2015-05-08T01:11:55Z We learned about the use of variant lox sites to produce random fluorescent protein expression from the "Brainbow" paper (http://www.nature.com/nature/journal/v450/n7166/full/nature06293.html). We discovered this specific sequence in "Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination" (http://www.ncbi.nlm.nih.gov/pubmed/9714735). The cre-lox system is used for site-specific recombination. Lox sites are 34 bp sequences of DNA that flank coding sequences. When cre recombinase is introduced, it can excise or invert the portions of DNA between two lox sites. If the two lox sites flanking the coding sequence are both forward or both reverse, the coding sequence will be excised, leaving one lox site behind. If the one site is forward and the other reverse, the coding sequence will be inverted. false false _435_ 0 7379 9 It's complicated false In constructing variant lox sites, we looked for the least promiscuous sites - those that had the lowest rates of recombination with other variants. false Tom Shuman BBa_S04460 1 BBa_S04460 R0040:K315004 2010-07-12T11:00:00Z 2015-05-08T01:14:40Z false false _9_ 0 7379 9 Not in stock false false Tom Shuman component2073306 1 BBa_R0040 component2073311 1 BBa_K315004 annotation2073311 1 BBa_K315004 range2073311 1 63 96 annotation2073306 1 BBa_R0040 range2073306 1 1 54 BBa_K315012 1 BBa_K315012 LoxBri (F) Variant forward lox site with 3 base changes in the spacer region 2010-06-23T11:00:00Z 2015-05-08T01:11:55Z We learned about the use of variant lox sites to produce random fluorescent protein expression from the "Brainbow" paper (http://www.nature.com/nature/journal/v450/n7166/full/nature06293.html). We discovered this specific sequence in "Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination" (http://www.ncbi.nlm.nih.gov/pubmed/9714735). [edit] The cre-lox system is used for site-specific recombination. Lox sites are 34 bp sequences of DNA that flank coding sequences. When cre recombinase is introduced, it can excise or invert the portions of DNA between two lox sites. If the two lox sites flanking the coding sequence are both forward or both reverse, the coding sequence will be excised, leaving one lox site behind. If one site is forward and the other reverse, the coding sequence will be inverted. false false _435_ 0 7370 9 It's complicated false In constructing variant lox sites, we looked for the least promiscuous sites - those that had the lowest rates of recombination with other variants. false Brianna Pearson annotation2071522 1 inverted repeat arm range2071522 1 1 13 annotation2071537 1 G -> A range2071537 1 20 20 annotation2071523 1 spacer region range2071523 1 14 21 annotation2071535 1 T -> A range2071535 1 15 15 annotation2071536 1 G -> C range2071536 1 16 16 annotation2071524 1 inverted repeat arm range2071524 1 22 34 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 BBa_S04493 1 BBa_S04493 S04487:K315012 2010-07-29T11:00:00Z 2015-05-08T01:14:40Z false false _9_ 0 7379 9 Not in stock false false Tom Shuman component2257739 1 BBa_S04487 component2257746 1 BBa_K315012 annotation2257739 1 BBa_S04487 range2257739 1 1 828 annotation2257746 1 BBa_K315012 range2257746 1 837 870 BBa_K093005_sequence 1 aaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K315004_sequence 1 ataacttcgtataagaaaccatatacgaagttat BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_S04487_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataagaaaccatatacgaagttattactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K315012_sequence 1 ataacttcgtataaactatactatacgaagttat BBa_S04460_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataagaaaccatatacgaagttat BBa_S04493_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtataagaaaccatatacgaagttattactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagataacttcgtataaactatactatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z