BBa_S04508 1 BBa_S04508 J13002:K300005 2010-10-16T11:00:00Z 2015-05-08T01:14:41Z true false _9_ 0 4140 9 Discontinued false false Giacomo Zambianchi component2088308 1 BBa_B0012 component2088297 1 BBa_R0040 component2088303 1 BBa_B0034 component2088305 1 BBa_K125500 component2088306 1 BBa_B0010 annotation2088308 1 BBa_B0012 range2088308 1 897 937 annotation2088305 1 BBa_K125500 range2088305 1 83 800 annotation2088297 1 BBa_R0040 range2088297 1 1 54 annotation2088306 1 BBa_B0010 range2088306 1 809 888 annotation2088303 1 BBa_B0034 range2088303 1 63 74 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K125500 1 BBa_K125500 GFP fusion brick 2008-07-24T11:00:00Z 2016-01-25T02:34:56Z The GFP fusion brick was derived from the GFP BioBrick, [http://partsregistry.org/Part:BBa_E0040 BBa_E0040]. false false _179_ 4206 3229 9 In stock false The first two nucleotides of the GFP start codon were removed to create this fusion brick. false Grace Kwan annotation1968260 1 GFP fusion brick range1968260 1 1 718 annotation1969908 1 deletion of TG range1969908 1 1 1 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K125500_sequence 1 cgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataat BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S04508_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagagcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z