BBa_K313013 1 BBa_K313013 loading sequence of RNA phage MS2 (reverse) 2010-10-21T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of oligonucleotide. lorem ipsum false false _433_ 0 5929 9 It's complicated false nothing special. false Ryosuke Kamei, Ryo Kariyazono, Yuka Yashiro, Mingshuo Zeng BBa_S04532 1 BBa_S04532 K313024:K313013 2010-10-26T11:00:00Z 2015-05-08T01:14:41Z false false _9_ 0 5939 9 It's complicated false false Masahiko Shimizu component2108229 1 BBa_K313024 component2108230 1 BBa_K313013 annotation2108229 1 BBa_K313024 range2108229 1 1 63 annotation2108230 1 BBa_K313013 range2108230 1 72 90 BBa_K313024 1 BBa_K313024 as RNA target1 2010-10-23T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of oligonucleotide. This is a part coding asRNA of BBa_K313023. false false _433_ 0 5929 9 Not in stock false nothing special false Ryo Kariyazono, Ryosuke Kamei, Mingshuo Zeng BBa_S04532_sequence 1 caggctgattacgtcacgcgctggtttctcctctttaatcaggctgattacgtcacgcgctggtactagagacatgggtaatcctcatgt BBa_K313013_sequence 1 acatgggtaatcctcatgt BBa_K313024_sequence 1 caggctgattacgtcacgcgctggtttctcctctttaatcaggctgattacgtcacgcgctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z