BBa_K313026 1 BBa_K313026 as RNA target2 2010-10-23T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of artificial oligonucleotide. This is the target sequence of asRNA BBa_K313025. false false _433_ 0 5929 9 Not in stock false nothing special false Ryo Kariyazono, Ryosuke Kamei, Mingshuo Zeng BBa_K313013 1 BBa_K313013 loading sequence of RNA phage MS2 (reverse) 2010-10-21T11:00:00Z 2015-05-08T01:11:54Z It was synthesized in the form of oligonucleotide. lorem ipsum false false _433_ 0 5929 9 It's complicated false nothing special. false Ryosuke Kamei, Ryo Kariyazono, Yuka Yashiro, Mingshuo Zeng BBa_S04533 1 BBa_S04533 K313026:K313013 2010-10-26T11:00:00Z 2015-05-08T01:14:41Z false false _9_ 0 5939 9 It's complicated false false Masahiko Shimizu component2108231 1 BBa_K313026 component2108232 1 BBa_K313013 annotation2108232 1 BBa_K313013 range2108232 1 72 90 annotation2108231 1 BBa_K313026 range2108231 1 1 63 BBa_K313026_sequence 1 cagatgtcgccgtgtgctgacaggtttctcctctttaatcagatgtcgccgtgtgctgacagg BBa_K313013_sequence 1 acatgggtaatcctcatgt BBa_S04533_sequence 1 cagatgtcgccgtgtgctgacaggtttctcctctttaatcagatgtcgccgtgtgctgacaggtactagagacatgggtaatcctcatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z