BBa_I13452 1 BBa_I13452 Adds another BioBrick site 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 Contains both a BbsI and a BstXI restriction site. When cut with both enzymes, it leaves an EcoRI and a PstI site. false false _11_ 0 253 6 In stock false 70 bp from Eco to Spe or Xba to Pst, to allow for gel extraction. The middle portion is largely noise, intended as filler to raise the size of the part. true jkm annotation1891622 1 Future Pst site range1891622 1 44 49 annotation1891621 1 BstXI site range1891621 1 41 52 annotation1891620 1 BbsI site range1891620 1 8 13 annotation1891619 1 Future Eco site range1891619 1 1 6 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S04542 1 BBa_S04542 I13452:B0034 2011-04-26T11:00:00Z 2015-05-08T01:14:41Z false false _9_ 0 6050 9 Not in stock false false Harland Brandon component2117831 1 BBa_I13452 component2117833 1 BBa_B0034 annotation2117833 1 BBa_B0034 range2117833 1 61 72 annotation2117831 1 BBa_I13452 range2117831 1 1 52 BBa_B0034_sequence 1 aaagaggagaaa BBa_S04542_sequence 1 gaattaggtcttcgaatcacaaagattagtcacacgcgatccattgcagtggtactagagaaagaggagaaa BBa_I13452_sequence 1 gaattaggtcttcgaatcacaaagattagtcacacgcgatccattgcagtgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z