BBa_K648028 1 BBa_K648028 Cro, Lamda Repressor which activates the lytic cycle 2011-07-24T11:00:00Z 2015-05-08T01:12:59Z Galen Lynch's notebook (Penn State iGEM 2007 member) Released HQ 2013 Cro is produced by the pr promoter in the lambda phage system. Normally C1 is repressing the pr promoter. However, when the lytic switch is thrown and RecA cleaves the C1 dimer the pr promoter is unrepressed. This results in the production of cro which in turn represses the prm promoter which halts the transcription of C1 repressor. In our project we used Cro to assemble our lambda system. false false _825_ 0 9891 9 In stock false false James Coletta, Anisha Katyal, Kristen Salavo, Lauren Rossi BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S04577 1 BBa_S04577 B0034:K648028 2011-07-24T11:00:00Z 2015-05-08T01:14:42Z false false _9_ 0 9891 9 Not in stock false false James Coletta, Anisha Katyal, Kristen Salavo component2124001 1 BBa_B0034 component2124002 1 BBa_K648028 annotation2124001 1 BBa_B0034 range2124001 1 1 12 annotation2124002 1 BBa_K648028 range2124002 1 19 219 BBa_K648028_sequence 1 atggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaagatctcggcgtatatcaaagcgcgatcaacaaggccattcatgcaggccgaaagatttttttaactataaacgctgatggaagcgtttatgcggaagaggtaaagcccttcccgagtaacaaaaaaacaacagcataa BBa_B0034_sequence 1 aaagaggagaaa BBa_S04577_sequence 1 aaagaggagaaatactagatggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaagatctcggcgtatatcaaagcgcgatcaacaaggccattcatgcaggccgaaagatttttttaactataaacgctgatggaagcgtttatgcggaagaggtaaagcccttcccgagtaacaaaaaaacaacagcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z