BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23038 1 BBa_J23038 [Pcon][RBS] 2006-07-31T11:00:00Z 2015-08-31T04:08:39Z Digest pSB1A2-RA2 from 1022 library (SpeI/AlwNI/PstI, Neb2, Large 1568 ) Paste into pSB1A2-B0034 (XbaI/AlwNI, Neb2, Small 566) Released HQ 2013 RA2 promoter from 1022 library with a ribosome binding site. false true _52_ 0 933 52 In stock false na false Samantha Liang component1893629 1 BBa_J23104 component1893631 1 BBa_B0034 annotation1893629 1 BBa_J23104 range1893629 1 1 35 annotation1893631 1 BBa_B0034 range1893631 1 44 55 BBa_S04590 1 BBa_S04590 J23104:B0034 2011-09-14T11:00:00Z 2015-05-08T01:14:42Z Released HQ 2013 true false _9_ 0 9115 9 Discontinued false false Julia M??ller component2128640 1 BBa_J23104 component2128642 1 BBa_B0034 annotation2128642 1 BBa_B0034 range2128642 1 44 55 annotation2128640 1 BBa_J23104 range2128640 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_S04590_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_J23038_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z