BBa_K519010 1 BBa_K519010 SmtA 2011-09-29T11:00:00Z 2016-01-13T10:24:13Z Synechococcus sp. PCC7942 Released HQ 2013 SmtA is a metallothionein that can bind to heavy metal ions such as Cd(II). This SmtA is cloned from Synechococcus sp. PCC7942 and it has been reported that the cyanobacterial strains that express SmtA can resist medium containing cadmim. false true _684_ 4206 9603 9 In stock false This part was cloned from Synechococcus sp. PCC7942, using primers to add EcoRI, XbaI and SpeI at the ends. false Kotone Miyake BBa_S04624 1 BBa_S04624 K519010:B0015 2011-09-29T11:00:00Z 2015-05-08T01:14:42Z false true _9_ 0 9603 9 It's complicated false false Kotone Miyake component2147655 1 BBa_B0015 component2147648 1 BBa_K519010 annotation2147648 1 BBa_K519010 range2147648 1 1 171 annotation2147655 1 BBa_B0015 range2147655 1 180 308 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_S04624_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K519010_sequence 1 atgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z