BBa_J176041 1 scar Silver scar 2011-10-04T11:00:00Z 2015-08-31T04:08:34Z This sequence is generated when BioBricks are assembled via assembly standard 23 (Silver standard). Six base pair scar between parts that have been assembled using BioBrick assembly standard 23 (Silver standard). false false _863_ 0 1144 61 Not in stock false The six base pair scar allows protein modules to be assembled in frame. This scar retains the triplet pattern for proper translation of the mRNA. Two extra amino acids, Thr and Arg, are introduced into the protein fusion, but in our hands, this does not disrupt the function of our synthetic mammalian parts. false Karmella Haynes BBa_J176019 1 5xGal4 5xGal4 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA target sequence of GAL4 DB; PCR cloned from pNEB false false _863_ 0 10865 9 Not in stock false TBA false Brady Laughlin annotation2159560 1 Gal4 range2159560 1 20 36 annotation2159562 1 Gal4 range2159562 1 58 74 annotation2159561 1 Gal4 range2159561 1 39 55 annotation2159563 1 Gal4 range2159563 1 77 93 annotation2159559 1 Gal4 range2159559 1 1 17 BBa_S04642 1 BBa_S04642 J176003:J176019 2011-10-03T11:00:00Z 2015-05-08T01:14:43Z false false _9_ 0 10865 9 Not in stock false false Brady Laughlin component2154771 1 BBa_J176019 component2154770 1 BBa_J176041 component2154769 1 BBa_J176003 annotation2154769 1 BBa_J176003 range2154769 1 1 368 annotation2154771 1 BBa_J176019 range2154771 1 375 467 annotation2154770 1 BBa_J176041 range2154770 1 369 374 BBa_J176003 1 Ubc Ubc 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA Ubc constitutive promoter false false _863_ 0 10865 9 Not in stock false TBA false Karmella Haynes BBa_J176003_sequence 1 aaactggcctccgcgccgggcttttggcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttccgcccggacgctcaggacagcggcccgctgctcataagactcggccttagaaccccagtatcagcagaaggacattttaggacgggacttgggtgactctagggcactggttttctttccagagagcggaacaggcgaggaaaagtagtcccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttactagacccgccgccaccatggag BBa_J176041_sequence 1 actaga BBa_J176019_sequence 1 cggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccg BBa_S04642_sequence 1 aaactggcctccgcgccgggcttttggcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttccgcccggacgctcaggacagcggcccgctgctcataagactcggccttagaaccccagtatcagcagaaggacattttaggacgggacttgggtgactctagggcactggttttctttccagagagcggaacaggcgaggaaaagtagtcccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttactagacccgccgccaccatggagactagacggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z