BBa_J176012 1 K Kozak 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA Released HQ 2013 yeast/ human Kozak plus start codon false false _863_ 0 10865 9 In stock false TBA false Brady Laughlin BBa_J176041 1 scar Silver scar 2011-10-04T11:00:00Z 2015-08-31T04:08:34Z This sequence is generated when BioBricks are assembled via assembly standard 23 (Silver standard). Six base pair scar between parts that have been assembled using BioBrick assembly standard 23 (Silver standard). false false _863_ 0 1144 61 Not in stock false The six base pair scar allows protein modules to be assembled in frame. This scar retains the triplet pattern for proper translation of the mRNA. Two extra amino acids, Thr and Arg, are introduced into the protein fusion, but in our hands, this does not disrupt the function of our synthetic mammalian parts. false Karmella Haynes BBa_J176003 1 Ubc Ubc 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA Ubc constitutive promoter false false _863_ 0 10865 9 Not in stock false TBA false Karmella Haynes BBa_S04654 1 BBa_S04654 J176003:J176012 2011-10-05T11:00:00Z 2015-05-08T01:14:43Z false false _9_ 0 10865 9 Not in stock false false Brady Laughlin component2155728 1 BBa_J176003 component2155730 1 BBa_J176012 component2155729 1 BBa_J176041 annotation2155729 1 BBa_J176041 range2155729 1 369 374 annotation2155728 1 BBa_J176003 range2155728 1 1 368 annotation2155730 1 BBa_J176012 range2155730 1 375 392 BBa_J176012_sequence 1 cccgccgccaccatggag BBa_J176003_sequence 1 aaactggcctccgcgccgggcttttggcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttccgcccggacgctcaggacagcggcccgctgctcataagactcggccttagaaccccagtatcagcagaaggacattttaggacgggacttgggtgactctagggcactggttttctttccagagagcggaacaggcgaggaaaagtagtcccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttactagacccgccgccaccatggag BBa_J176041_sequence 1 actaga BBa_S04654_sequence 1 aaactggcctccgcgccgggcttttggcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttccgcccggacgctcaggacagcggcccgctgctcataagactcggccttagaaccccagtatcagcagaaggacattttaggacgggacttgggtgactctagggcactggttttctttccagagagcggaacaggcgaggaaaagtagtcccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttactagacccgccgccaccatggagactagacccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z