BBa_S04716 1 BBa_S04716 K239006:B0034 2011-10-08T11:00:00Z 2015-05-08T01:14:44Z false false _9_ 0 10148 9 Not in stock false false Ejaj Intisar component2157828 1 BBa_K239006 component2157830 1 BBa_B0034 annotation2157830 1 BBa_B0034 range2157830 1 98 109 annotation2157828 1 BBa_K239006 range2157828 1 1 89 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K239006 1 BBa_K239006 Modified NarK promoter 2009-06-25T11:00:00Z 2015-05-08T01:11:36Z Raw genomic sequence from biocyc, Escherichia coli K-12, but modified. Sequence contains 2 Fnr (one of which is modified), 1 Fis, 2 NarL binding sites and initiates transcription by RNAP sigma-70. Function: Switched on during anaerobic conditions. Area of application: Detection of when the cell is switching to anaerobic metabolism. false false _375_ 0 4247 9 It's complicated false Detect and remove possible restriction sites: XbaI, EcoRI, PstI, SpeI, AgeI, BamHI, BglII, NogMIV, NotI and XhoI. No restriction site had to be removed. Sequence starts 3 bp before the first FNR binding site and ends 6 pb after the -10 box. One pb has been changed in order optimise the first FNR binding site. false Axel Nystrom annotation2006726 1 NarL range2006726 1 7 13 annotation2006721 1 -35 range2006721 1 48 56 annotation2006725 1 NarL range2006725 1 20 26 annotation2006723 1 Fis range2006723 1 38 56 annotation2006720 1 -10 range2006720 1 76 83 annotation2006724 1 Fnr range2006724 1 4 17 annotation2006722 1 Fnr range2006722 1 42 55 BBa_B0034_sequence 1 aaagaggagaaa BBa_S04716_sequence 1 gtattgataaatatcaatgatagataaagttatcttatcgtttgatttacatcaaattgcctttagctacagacactaaggtggcagactactagagaaagaggagaaa BBa_K239006_sequence 1 gtattgataaatatcaatgatagataaagttatcttatcgtttgatttacatcaaattgcctttagctacagacactaaggtggcagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z