BBa_J176011 1 HSVtk HSVtk TATA 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA Minimal promoter false false _863_ 0 10865 9 Not in stock false TBA false Brady Laughlin BBa_J176041 1 scar Silver scar 2011-10-04T11:00:00Z 2015-08-31T04:08:34Z This sequence is generated when BioBricks are assembled via assembly standard 23 (Silver standard). Six base pair scar between parts that have been assembled using BioBrick assembly standard 23 (Silver standard). false false _863_ 0 1144 61 Not in stock false The six base pair scar allows protein modules to be assembled in frame. This scar retains the triplet pattern for proper translation of the mRNA. Two extra amino acids, Thr and Arg, are introduced into the protein fusion, but in our hands, this does not disrupt the function of our synthetic mammalian parts. false Karmella Haynes BBa_S04743 1 BBa_S04743 J176039:J176011 2011-10-14T11:00:00Z 2015-05-08T01:14:44Z false false _9_ 0 10865 9 Not in stock false false Brady Laughlin component2220029 1 BBa_J176011 component2220027 1 BBa_J176039 component2220028 1 BBa_J176041 annotation2220029 1 BBa_J176011 range2220029 1 49 104 annotation2220028 1 BBa_J176041 range2220028 1 43 48 annotation2220027 1 BBa_J176039 range2220027 1 1 42 BBa_J176039 1 Spacer Spacer 2011-09-28T11:00:00Z 2015-08-31T04:08:33Z TBA Noncoding spacer to put between TF binding site and TATA false false _863_ 0 10865 9 Not in stock false TBA false Brady Laughlin, Karmella Haynes BBa_S04743_sequence 1 gtgacgccggtgacgccgactagagtgacgccggtgacgccgactagagtccacttcgcatattaaggtgacgcgtgtggcctcgaacaccgagcgaccctgca BBa_J176039_sequence 1 gtgacgccggtgacgccgactagagtgacgccggtgacgccg BBa_J176041_sequence 1 actaga BBa_J176011_sequence 1 gtccacttcgcatattaaggtgacgcgtgtggcctcgaacaccgagcgaccctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z