BBa_S05002 1 BBa_S05002 J119029:B0034 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169100 1 BBa_J119029 component2169102 1 BBa_B0034 annotation2169100 1 BBa_J119029 range2169100 1 1 46 annotation2169102 1 BBa_B0034 range2169102 1 55 66 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J119029 1 BBa_J119029 P2 Promoter - High efficiency 2011-12-22T12:00:00Z 2015-10-01T11:36:08Z Synthetic DNA. P2 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik annotation2167466 1 -10 range2167466 1 34 46 annotation2167465 1 -35 range2167465 1 1 17 BBa_B0034_sequence 1 aaagaggagaaa BBa_J119029_sequence 1 aaaaagagtattgacttcgcatctttttgtacctataatgtgtgga BBa_S05002_sequence 1 aaaaagagtattgacttcgcatctttttgtacctataatgtgtggatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z