BBa_S05005 1 BBa_S05005 J119032:B0034 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169111 1 BBa_B0034 component2169109 1 BBa_J119032 annotation2169109 1 BBa_J119032 range2169109 1 1 35 annotation2169111 1 BBa_B0034 range2169111 1 44 55 BBa_J119032 1 BBa_J119032 P9 Promoter - Low efficiency 2011-12-22T12:00:00Z 2015-10-01T11:40:54Z Synthetic DNA. P9 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S05005_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtggatactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_J119032_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z