BBa_S05009 1 BBa_S05009 J119033:J119025 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169172 1 BBa_J119033 component2169178 1 BBa_J119025 annotation2169172 1 BBa_J119033 range2169172 1 1 36 annotation2169178 1 BBa_J119025 range2169178 1 37 124 BBa_J119025 1 BBa_J119025 BD2 bicistronic translational junction - Lowest efficiency 2011-12-21T12:00:00Z 2015-10-01T11:42:55Z Synthetic DNA The BD2 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167445 1 leader RBS range2167445 1 19 27 annotation2167447 1 Start range2167447 1 86 88 annotation2167448 1 Stop range2167448 1 84 86 annotation2167449 1 GOI RBS range2167449 1 71 79 annotation2167446 1 Start range2167446 1 33 35 BBa_J119033 1 BBa_J119033 P14 Promoter - Medium efficiency 2011-12-22T12:00:00Z 2015-10-01T11:41:31Z Synthetic DNA. P14 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. Derived from pTrc promoter. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_J119033_sequence 1 ttgacaattaatcatccggctcgtataatgtgtgga BBa_J119025_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_S05009_sequence 1 ttgacaattaatcatccggctcgtataatgtgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z