BBa_J119025 1 BBa_J119025 BD2 bicistronic translational junction - Lowest efficiency 2011-12-21T12:00:00Z 2015-10-01T11:42:55Z Synthetic DNA The BD2 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167447 1 Start range2167447 1 86 88 annotation2167448 1 Stop range2167448 1 84 86 annotation2167449 1 GOI RBS range2167449 1 71 79 annotation2167445 1 leader RBS range2167445 1 19 27 annotation2167446 1 Start range2167446 1 33 35 BBa_J119032 1 BBa_J119032 P9 Promoter - Low efficiency 2011-12-22T12:00:00Z 2015-10-01T11:40:54Z Synthetic DNA. P9 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_S05010 1 BBa_S05010 J119032:J119025 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169192 1 BBa_J119025 component2169186 1 BBa_J119032 annotation2169186 1 BBa_J119032 range2169186 1 1 35 annotation2169192 1 BBa_J119025 range2169192 1 36 123 BBa_S05010_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_J119025_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_J119032_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z