BBa_J119027 1 BBa_J119027 BD21 bicistronic translational junction - High efficiency 2011-12-21T12:00:00Z 2015-10-01T11:43:50Z Synthetic DNA. The BD21 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org]. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167459 1 Stop range2167459 1 84 86 annotation2167456 1 Start range2167456 1 86 88 annotation2167455 1 Start range2167455 1 33 35 annotation2167457 1 leader RBS range2167457 1 19 27 annotation2167458 1 GOI RBS range2167458 1 71 79 BBa_J119029 1 BBa_J119029 P2 Promoter - High efficiency 2011-12-22T12:00:00Z 2015-10-01T11:36:08Z Synthetic DNA. P2 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik annotation2167466 1 -10 range2167466 1 34 46 annotation2167465 1 -35 range2167465 1 1 17 BBa_S05022 1 BBa_S05022 J119029:J119027 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169384 1 BBa_J119027 component2169378 1 BBa_J119029 annotation2169384 1 BBa_J119027 range2169384 1 47 134 annotation2169378 1 BBa_J119029 range2169378 1 1 46 BBa_S05022_sequence 1 aaaaagagtattgacttcgcatctttttgtacctataatgtgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgagggatggtttctaatg BBa_J119027_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgagggatggtttctaatg BBa_J119029_sequence 1 aaaaagagtattgacttcgcatctttttgtacctataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z