BBa_J119032 1 BBa_J119032 P9 Promoter - Low efficiency 2011-12-22T12:00:00Z 2015-10-01T11:40:54Z Synthetic DNA. P9 promoter engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. false false _613_ 606 606 61 Not in stock false Designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org] for use in testing bicistronic translational junctions (eg. http://partsregistry.org/Part:BBa_J119024). false Vivek Mutalik BBa_S05030 1 BBa_S05030 J119032:J119028 2012-01-09T12:00:00Z 2015-05-08T01:14:48Z false false _61_ 0 201 61 Not in stock false false Malcolm Campbell component2169498 1 BBa_J119032 component2169504 1 BBa_J119028 annotation2169504 1 BBa_J119028 range2169504 1 36 123 annotation2169498 1 BBa_J119032 range2169498 1 1 35 BBa_J119028 1 BBa_J119028 BD24 bicistronic translational junction - Highest efficiency 2011-12-21T12:00:00Z 2015-10-01T11:44:13Z Synthetic DNA. The BD24 bicistronic translational junction was engineered by Vivek Mutalik and The BIOFAB Team at biofab.org. It includes an RBS that allows translation of a leader polypeptide. The leader has a second RBS embedded in it. The stop codon for the leader polypeptide overlaps with the start codon for the gene of interest. false false _613_ 606 606 61 Not in stock false The bicistronic translational junction was designed by Team Leader Vivek Mutalik at BioFAB [http://www.biofab.org]. It is is intended to give reproducible and consistent expression for various genes of interest. false Vivek Mutalik annotation2167462 1 Stop range2167462 1 84 86 annotation2167463 1 leader RBS range2167463 1 19 27 annotation2167464 1 GOI RBS range2167464 1 71 79 annotation2167460 1 Start range2167460 1 33 35 annotation2167461 1 Start range2167461 1 86 88 BBa_J119028_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggacggtttctaatg BBa_S05030_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtggagggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggacggtttctaatg BBa_J119032_sequence 1 ttgcctcttaatcatcggctcgtataatgtgtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z