BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_S05056 1 BBa_S05056 J23106:B0034 2012-09-17T11:00:00Z 2015-05-08T01:14:49Z true false _9_ 0 14291 9 Discontinued false false Chunyan Zhang component2184797 1 BBa_B0034 component2184795 1 BBa_J23106 annotation2184797 1 BBa_B0034 range2184797 1 44 55 annotation2184795 1 BBa_J23106 range2184795 1 1 35 BBa_K188121 1 BBa_K188121 Pconstitutive+RBS 2009-10-16T11:00:00Z 2015-05-08T01:11:13Z NONE Pconstitutive+RBS false true _296_ 0 4218 9 It's complicated false NONE false shau-yi wu component2048664 1 BBa_B0034 component2048662 1 BBa_J23106 annotation2048662 1 BBa_J23106 range2048662 1 1 35 annotation2048664 1 BBa_B0034 range2048664 1 44 55 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_S05056_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaa BBa_K188121_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z