BBa_S05057 1 BBa_S05057 K737017:B0015 2012-09-17T11:00:00Z 2015-05-08T01:14:49Z true false _9_ 0 14291 9 Discontinued false false Chunyan Zhang component2184798 1 BBa_K737017 component2184805 1 BBa_B0015 annotation2184805 1 BBa_B0015 range2184805 1 513 641 annotation2184798 1 BBa_K737017 range2184798 1 1 504 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K737017 1 BBa_K737017 This part conteins gvpC-20psi protein 2012-09-17T11:00:00Z 2015-05-08T01:13:07Z Yes Released HQ 2013 This part conteins gvpA protein's coding sequence. This gene from Planktothrix rubescens can be succesfully expressed in E. coli. The gvpA's expression have been examined by another part " J23106+B0034+gvpA+B0015". (Since it was ligated on cloning vector pSB4A5, we didn't register this part. The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false false _986_ 0 14291 9 In stock false The gvpA protein conteins a typical domain of the superfamily 'Gas vesicle'(NCBI CDD cl02594). This gene is quiet conserved in most gvp's polycistron. According to Anthony E. Walsby's research, gas vesicles have a similar morphology. GvpA protein is a kind of small hydrophobic protein which forms the ribs of the main structure. 'All cyanobacterial gas vesicles so far analyzed contain a protein (GvpA) of about 7.4 kDa that forms the main mass of the structure and must be responsible for many of its properties.' (Gas Vesicles. Microbiological Reviews. A. E. Walsby) false Jiaheng Li BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K737017_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaa BBa_S05057_sequence 1 atggctttaaaagacaagtggcaacaggatcgtatcggacgccaacagggagttcaagaacggcaacagcaagttcaaaccaccctatccctctggcaacaagagcgccaaaatcaggcttctgaatttcgggaagacctagaatatcgggtaacggatctgttagctaattatcagaaacagcgcctagaagctagggaaactttacttgaggacttagctatttttcgtcaaaccctatatcgggaagtcgaagaatatttaggggagttagatattctgcaccagcaaatggccgcacaattacaacaacaactccaacagagtcggacggaaagaaaagacgctgttcagaagttattcgaggatttaggggtatttcgcgccgaactacaagactatcacctcaaacttcaacagacagtttgggggagttcccaccgaaaaccgcgaaaagcgattaccccgcaacgctctattccatcgcgtttatattcctgttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z