BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_S05060 1 BBa_S05060 K873000:B0015 2012-09-18T11:00:00Z 2015-05-08T01:14:49Z Released HQ 2013 false false _9_ 0 11547 9 In stock false false yue hu component2185406 1 BBa_K873000 component2185413 1 BBa_B0015 annotation2185406 1 BBa_K873000 range2185406 1 1 294 annotation2185413 1 BBa_B0015 range2185413 1 303 431 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K873000 1 BBa_K873000 heat shock 10kDa protein(hsp 10) groES coding resquence 2012-09-17T11:00:00Z 2015-05-08T01:13:38Z We gained it through PCR from the genome of Escherichia coli BL21(DE3), data were achieved from NCBI. Heat shock 10 kDa protein 1 (Hsp10) also known as chaperonin 10 (cpn10) or early-pregnancy factor (EPF) is a protein that in humans is encoded by the HSPE1 gene. The homolog in E. coli is GroES that is a chaperonin which usually works in conjunction with GroEL.[1] false false _1134_ 0 12429 9 It's complicated false groES is considered to cooprate with groEL to play the repair function, and we just try to use the only groES to make effects. false Yue Hu BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K873000_sequence 1 atgaacatccgtccgctgcatgaccgtgtgattgtgaaacgcaaagaagtggaaaccaagtcggcaggtggcattgtgctgaccggcagcgcggccgcaaaatctacccgtggtgaagtcctggcagtgggtaacggtcgcattctggaaaatggcgaagtgaaaccgctggatgtgaaggttggtgacattgttatctttaacgatggctatggtgtcaaaagtgaaaagatcgacaatgaagaagtcctgattatgagcgaaagtgacatcctggctatcgtggaagcgtaa BBa_S05060_sequence 1 atgaacatccgtccgctgcatgaccgtgtgattgtgaaacgcaaagaagtggaaaccaagtcggcaggtggcattgtgctgaccggcagcgcggccgcaaaatctacccgtggtgaagtcctggcagtgggtaacggtcgcattctggaaaatggcgaagtgaaaccgctggatgtgaaggttggtgacattgttatctttaacgatggctatggtgtcaaaagtgaaaagatcgacaatgaagaagtcctgattatgagcgaaagtgacatcctggctatcgtggaagcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z